Na našich webových stránkách používáme soubory cookies. Některé z nich jsou nezbytné, zatímco jiné nám pomáhají vylepšit tento web a váš uživatelský zážitek. Souhlasíte s používáním všech cookies?
Cookies nastavení
Vaše soukromí je důležité. Můžete si vybrat nastavení cookies níže.
5'-d(CAGGAAACAGCTATGAC)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19-based cloning vectors.
5'-d(GAGCGGATAACAATTTCACACAGG)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
5'-d(GTTTTCCCAGTCACGAC)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II
Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II
Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II
Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II
Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II