Primers for Sequencing

Probíhá načítání komponenty

Obrázkový výpis Tabulkový výpis Řádkový výpis

12 položek

M13/pUC Reverse Sequencing Primer (-26), 17-mer

5'-d(CAGGAAACAGCTATGAC)-3' M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19-based cloning vectors.

1 485,88 Kč Cena bez DPH 1 228,00 Kč

do týdne

M13/pUC Reverse Sequencing Primer (-46), 24-mer

5'-d(GAGCGGATAACAATTTCACACAGG)-3' M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.

1 510,08 Kč Cena bez DPH 1 248,00 Kč

do týdne

M13/pUC Sequencing Primer (-20), 17-mer

5'-d(GTAAAACGACGGCCAGT)-3' M13 pUC sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.

1 485,88 Kč Cena bez DPH 1 228,00 Kč

Skladem

M13/pUC Sequencing Primer (-40), 17-mer

5'-d(GTTTTCCCAGTCACGAC)-3' M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.

1 495,56 Kč Cena bez DPH 1 236,00 Kč

do týdne

M13/pUC Sequencing Primer (-46), 22-mer

5'-d(GCCAGGGTTTTCCCAGTCACGA)-3' M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.

1 485,88 Kč Cena bez DPH 1 228,00 Kč

do týdne

pJET1.2 Forward Sequencing Primer, 23-mer

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR.

2 262,70 Kč Cena bez DPH 1 870,00 Kč

do týdne

pJET1.2 Reverse Sequencing Primer, 24-mer

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR.

2 260,28 Kč Cena bez DPH 1 868,00 Kč

do týdne