M13/pUC Reverse Sequencing Primer (-46), 24-mer
Kód produktu: SO115
Kód výrobce: SO115
Kód dodavatele: {CBC45FAE-299D-487B-8603-4DBF2206B506}
Výrobce:
Life Technologies Czech Republic s.r.o.
5'-d(GAGCGGATAACAATTTCACACAGG)-3'
![Store at -20°C Store at -20°C](http://www.thermoscientificbio.com/uploadedImages/Products/Nucleotides_and_Primers/Molecular_Cloning/minus20.gif)
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
Detailní popis
The Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.
Applications
- Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
- Colony screening by PCR
Hazardous | No |
Quality Control | Functionally tested by dideoxy sequencing of pUC19 DNA. |
Storage Condition | -20 C |
Hodnocení produktu
Produkt zatím nikdo nehodnotil, buďte první!