Tento e-shop využívá cookies

Na našich webových stránkách používáme soubory cookies. Některé z nich jsou nezbytné, zatímco jiné nám pomáhají vylepšit tento web a váš uživatelský zážitek. Souhlasíte s používáním všech cookies?

Cookies nastavení

Vaše soukromí je důležité. Můžete si vybrat nastavení cookies níže.


 Za nukleotidy můžeme považovat základní jednotky molekul nukleových kyselin, které se liší obsahem dusíkatých bází a schopností tvořit vodíkové vazby. Molekuly nukleových kyselin mohou být jednořetězcové (RNA) nebo dvouřetězcové (DNA). Vznikají činností polymeráz, které jako stavební kameny používají nukleosidtrifosfáty. Spojovací molekulou řetězců jsou zbytky pentóz, které svými vazbami určují směr 5´"3´.

Meziřetězcové vodíkové vazby mezi bázemi vznikají podle pravidla párování A-T, C-G a pro vznik dvouřetězcové molekuly je typické antiparalení uložení řetězců. Vodíkové vazby lze zrušit (denaturace) zvýšením teploty (nad 900C) iontovou silou a změnou pH. Po návratu k původním hodnotám se vodíkové vazby znovu vytvoří (hybridizace, annealing).

Krátké sekvence nukleotidů lze použít jako priméry tedy startovní místo pro polymerázy, nebo jako sondy – vyhledání komplementárních úseků v analyzované DNA.

Probíhá načítání komponenty
SP6 promoter Sequencing Primer, 24-mer

SP6 promoter Sequencing Primer, 24-mer

do týdne
1 316,48 Kč
1 088,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T7 promoter Sequencing Primer, 20-mer

T7 promoter Sequencing Primer, 20-mer

do týdne
1 323,74 Kč
1 094,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T3 promoter Sequencing Primer, 17-mer

T3 promoter Sequencing Primer, 17-mer

do týdne
1 326,16 Kč
1 096,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
M13/pUC Reverse Sequencing Primer (-26), 17-mer

M13/pUC Reverse Sequencing Primer (-26),...

1 331,00 Kč
1 100,00 Kč bez DPH
5'-d(CAGGAAACAGCTATGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
M13/pUC Sequencing Primer (-20), 17-mer

M13/pUC Sequencing Primer (-20), 17-mer

1 331,00 Kč
1 100,00 Kč bez DPH
5'-d(GTAAAACGACGGCCAGT)-3' M13 pUC sequencing primers are single-stranded oligonucle...
M13/pUC Sequencing Primer (-46), 22-mer

M13/pUC Sequencing Primer (-46), 22-mer

do týdne
1 331,00 Kč
1 100,00 Kč bez DPH
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3' M13 pUC sequencing primers are single-stranded olig...
M13/pUC Sequencing Primer (-40), 17-mer

M13/pUC Sequencing Primer (-40), 17-mer

do týdne
1 340,68 Kč
1 108,00 Kč bez DPH
5'-d(GTTTTCCCAGTCACGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
T3 promoter Sequencing Primer, 24-mer

T3 promoter Sequencing Primer, 24-mer

do týdne
1 352,78 Kč
1 118,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
M13/pUC Reverse Sequencing Primer (-46), 24-mer

M13/pUC Reverse Sequencing Primer (-46),...

do týdne
1 352,78 Kč
1 118,00 Kč bez DPH
5'-d(GAGCGGATAACAATTTCACACAGG)-3' M13 pUC sequencing primers are single-st...
SP6 promoter Sequencing Primer, 18-mer

SP6 promoter Sequencing Primer, 18-mer

do týdne
1 355,20 Kč
1 120,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
Lambda DNA (dam–, dcm–)

Lambda DNA (dam–, dcm–)

do týdne
1 752,08 Kč
1 448,00 Kč bez DPH
Lambda DNA is a common substrate for restriction endonucleases and for generati...
Lambda DNA

Lambda DNA

do týdne
1 790,80 Kč
1 480,00 Kč bez DPH
Lambda DNA is a common substrate for restriction endonucleases and for generati...