M13/pUC Sequencing Primer (-46), 22-mer
Kód produktu: SO114
Kód výrobce: SO114
Kód dodavatele: {FE44CA03-A171-4DCF-B7F6-5A79228D1515}
Výrobce:
Life Technologies Czech Republic s.r.o.
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
Detailní popis
The Thermo Scientific M13/pUC sequencing primers anneal to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 µM aqueous solutions.
Applications
- Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
- Colony screening by PCR
| Hazardous | No |
| Quality Control |
Functionally tested by dideoxy sequencing of pUC19 DNA. |
| Storage Condition | -20 C |
Hodnocení produktu
Produkt zatím nikdo nehodnotil, buďte první!