SP6 promoter Sequencing Primer, 24-mer
Detailní popis
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the SP6, T3, or T7 RNA polymerase promoter regions respectively. Primers are supplied as 10 µM aqueous solutions.
Applications
- Sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II
Quality Control
Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.
Catalog | Promoter sequence |
---|---|
SO116 | SP6 promoter sequencing primer, 18-mer 5'-d (ATTTAGGTGACACTATAG)-3' |
SO117 | SP6 promoter sequencing primer, 24-mer 5'-d (CATACGATTTAGGTGACACTATAG)-3' |
SO118 | T7 promoter sequencing primer, 20-mer 5'-d (TAATACGACTCACTATAGGG)-3' |
SO119 | T3 promoter sequencing primer, 17-mer 5'-d (ATTAACCCTCACTAAAG)-3' |
SO120 | T3 promoter sequencing primer, 24-mer 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3' |
Note
Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.
Hazardous | No |
Storage Condition | -20 C |
Hodnocení produktu
Produkt zatím nikdo nehodnotil, buďte první!