T3 promoter Sequencing Primer, 17-mer

Kód produktu: SO119 Kód výrobce: SO119 Kód dodavatele: {ACFC9277-DD2F-4BD0-8AEA-DE1F7272190F} Výrobce: UAB Fermentas
1 161,60 Kč
960,00 Kč bez DPH
do týdne
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II
Zobraz detailní popis

Detailní popis

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the SP6, T3, or T7 RNA polymerase promoter regions respectively. Primers are supplied as 10 µM aqueous solutions.


  • Sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control

Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog Promoter sequence
SO116 SP6 promoter sequencing primer, 18-mer 5'-d (ATTTAGGTGACACTATAG)-3' 
SO117 SP6 promoter sequencing primer, 24-mer 5'-d (CATACGATTTAGGTGACACTATAG)-3' 
SO118 T7 promoter sequencing primer, 20-mer 5'-d (TAATACGACTCACTATAGGG)-3' 
SO119 T3 promoter sequencing primer, 17-mer 5'-d (ATTAACCCTCACTAAAG)-3' 
SO120 T3 promoter sequencing primer, 24-mer 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3' 


Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Hazardous No
Storage Condition -20 C

Hodnocení produktu

Produkt zatím nikdo nehodnotil, buďte první!

Napište hodnocení