Tento e-shop využívá cookies

Na našich webových stránkách používáme soubory cookies. Některé z nich jsou nezbytné, zatímco jiné nám pomáhají vylepšit tento web a váš uživatelský zážitek. Souhlasíte s používáním všech cookies?

Cookies nastavení

Vaše soukromí je důležité. Můžete si vybrat nastavení cookies níže.

pJET1.2 Forward Sequencing Primer, 23-mer

Kód produktu: SO501 Kód výrobce: SO501 Kód dodavatele: {DE906019-2AA5-404D-820C-343B88E2020B} Výrobce: Life Technologies Czech Republic s.r.o.
2 194,94 Kč
1 814,00 Kč bez DPH
do týdne
0.2 AU
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR.
Zobraz detailní popis
  • Zeptejte se odborníka

Detailní popis

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2pJET1.2 sequence sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2pJET1.2 sequence. All primers are supplied as 10 µM aqueous solutions.

Applications

  • Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2pJET1.2 sequence
  • Colony screening by PCR

Click here for the pJET1.2 sequencepJET1.2 sequence

Catalog# Primer sequence
SO501 pJET1.2 forward sequencing primer, 23-mer
5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
SO511 pJET1.2 reverse sequencing primer, 24-mer
5'-d(AAGAACATCGATTTTCCATGGCAG)-3'
Hazardous No
Quality Control Functionally tested by dideoxy sequencing of pJET1.2 DNA.
Storage Condition -20 C

Hodnocení produktu

Produkt zatím nikdo nehodnotil, buďte první!