pJET1.2 Reverse Sequencing Primer, 24-mer
Kód produktu: SO511
Kód výrobce: SO511
Kód dodavatele: {C3E83B6F-DD43-4ECC-8CC2-37B738A3209C}
Výrobce:
Life Technologies Czech Republic s.r.o.
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR.
Detailní popis
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2
. All primers are supplied as 10 µM aqueous solutions.
Applications
- Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2
- Colony screening by PCR
Click here for the pJET1.2 sequence
| Catalog# | Primer sequence |
|---|---|
| SO501 | pJET1.2 forward sequencing primer, 23-mer5'-d(CGACTCACTATAGGGAGAGCGGC)-3' |
| SO511 | pJET1.2 reverse sequencing primer, 24-mer5'-d(AAGAACATCGATTTTCCATGGCAG)-3' |
| Hazardous | No |
| Quality Control | Functionally tested by dideoxy sequencing of pJET1.2 DNA. |
| Storage Condition | -20 C |
Hodnocení produktu
Produkt zatím nikdo nehodnotil, buďte první!