Reagencie - Life Technologies Czech Republic s.r.o.
Probíhá načítání komponenty
1140 položek
M13/pUC Reverse Sequencing Primer (-46), 24-mer
5'-d(GAGCGGATAACAATTTCACACAGG)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
1 510,08 Kč
Cena bez DPH 1 248,00 Kč
do týdne
SP6 promoter Sequencing Primer, 18-mer
Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II
1 512,50 Kč
Cena bez DPH 1 250,00 Kč
do týdne
SP6 promoter Sequencing Primer, 24-mer
Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II
1 471,36 Kč
Cena bez DPH 1 216,00 Kč
do týdne
T7 promoter Sequencing Primer, 20-mer
Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II
1 478,62 Kč
Cena bez DPH 1 222,00 Kč
do týdne
M13/pUC Sequencing Primer (-20), 17-mer
5'-d(GTAAAACGACGGCCAGT)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.
1 485,88 Kč
Cena bez DPH 1 228,00 Kč
Skladem
T3 promoter Sequencing Primer, 17-mer
Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II
1 437,48 Kč
Cena bez DPH 1 188,00 Kč
do týdne
T3 promoter Sequencing Primer, 24-mer
Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II
1 510,08 Kč
Cena bez DPH 1 248,00 Kč
do týdne
MagJET Plasmid DNA Kit
.
Purifies plasmid DNA from overnight E. coli cultures using paramagnetic bead technology.
20 703,10 Kč
Cena bez DPH 17 110,00 Kč
do týdne
Bsm DNA Polymerase, Large Fragment
FastDigest buffer for 100% activity G buffer for 100% activity LO certified O buffer for 100% activity Recombinant enzyme R buffer for 100% activity Tango buffer for 100% activity Thermal inactivation at 80°C in 10 min
DNA polymerase with a high functional similarity to Bst DNA Polymerase and with a strong strand displacement activity.
2 492,60 Kč
Cena bez DPH 2 060,00 Kč
do týdne
GeneRuler™ Ultra Low Range DNA Ladder, ready-to-use
The ladder is recommended for analysis of small dsDNA fragments on agarose or polyacrylamide gels. Ideal for siRNA analysis. Premixed with Loading Dye for direct loading onto gel.
3 206,50 Kč
Cena bez DPH 2 650,00 Kč
do týdne
O’GeneRuler™ Ultra Low Range DNA Ladder, ready-to-use
Low range DNA ladder for sizing and approximate quantification of double-stranded DNA on agarose gels. The ladder is premixed with blue and yellow tracking dyes.
3 260,95 Kč
Cena bez DPH 2 695,00 Kč
do týdne
GeneRuler™ 1 kb Plus DNA Ladder, ready-to-use
GeneRuler 1kb Plus DNA Ladder is recommended for sizing and approximate quantification of a wide range of double-stranded DNA on agarose gels.
2 243,34 Kč
Cena bez DPH 1 854,00 Kč
do týdne