Tento e-shop využívá cookies

Na našich webových stránkách používáme soubory cookies. Některé z nich jsou nezbytné, zatímco jiné nám pomáhají vylepšit tento web a váš uživatelský zážitek. Souhlasíte s používáním všech cookies?

Cookies nastavení

Vaše soukromí je důležité. Můžete si vybrat nastavení cookies níže.

Life Technologies Czech Republic s.r.o. Life Technologies Czech Republic s.r.o.

M13/pUC Reverse Sequencing Primer (-26), 17-mer

M13/pUC Reverse Sequencing Primer (-26),...

do týdne
1 485,88 Kč
1 228,00 Kč bez DPH
0.1 AU
5'-d(CAGGAAACAGCTATGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
M13/pUC Reverse Sequencing Primer (-46), 24-mer

M13/pUC Reverse Sequencing Primer (-46),...

do týdne
1 510,08 Kč
1 248,00 Kč bez DPH
0.1 AU
5'-d(GAGCGGATAACAATTTCACACAGG)-3' M13 pUC sequencing primers are single-st...
M13/pUC Sequencing Primer (-20), 17-mer

M13/pUC Sequencing Primer (-20), 17-mer

Skladem
1 485,88 Kč
1 228,00 Kč bez DPH
0.1 AU
5'-d(GTAAAACGACGGCCAGT)-3' M13 pUC sequencing primers are single-stranded oligonucle...
M13/pUC Sequencing Primer (-40), 17-mer

M13/pUC Sequencing Primer (-40), 17-mer

do týdne
1 495,56 Kč
1 236,00 Kč bez DPH
0.1 AU
5'-d(GTTTTCCCAGTCACGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
M13/pUC Sequencing Primer (-46), 22-mer

M13/pUC Sequencing Primer (-46), 22-mer

do týdne
1 485,88 Kč
1 228,00 Kč bez DPH
0.1 AU
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3' M13 pUC sequencing primers are single-stranded olig...
MagJET NGS Cleanup and Size Selection Kit

MagJET NGS Cleanup and Size Selection Ki...

do týdne
1 241,46 Kč
1 026,00 Kč bez DPH
10 preps
Purify and recover selected sizes of your DNA fragment library from upstream reaction...
MagJET NGS Cleanup and Size Selection Kit

MagJET NGS Cleanup and Size Selection Ki...

do týdne
6 969,60 Kč
5 760,00 Kč bez DPH
Purify and recover selected sizes of your DNA fragment library from upstream reacti...
MagJET NGS Cleanup and Size Selection Kit

MagJET NGS Cleanup and Size Selection Ki...

do týdne
51 933,20 Kč
42 920,00 Kč bez DPH
Purify and recover selected sizes of your DNA fragment library from upstream reaction...
MagJET NGS Cleanup and Size Selection Kit

MagJET NGS Cleanup and Size Selection Ki...

do týdne
22 627,00 Kč
18 700,00 Kč bez DPH
.Purify and recover selected sizes of your DNA fragment library from upstream reactio...
MagJET Plasmid DNA Kit

MagJET Plasmid DNA Kit

do týdne
20 703,10 Kč
17 110,00 Kč bez DPH
. Purifies plasmid DNA from overnight E. coli cultures using paramagnetic bead tec...
MagJET Plasmid DNA Kit

MagJET Plasmid DNA Kit

do týdne
5 886,65 Kč
4 865,00 Kč bez DPH
Purifies plasmid DNA from overnight E. coli cultures using paramagnetic bead technolo...
MagJET Rack, 12x1.5 mL

MagJET Rack, 12x1.5 mL

do týdne
13 673,00 Kč
11 300,00 Kč bez DPH
. The MagJET separation rack allows fast and efficient procedures for magnetic ...