Molecular Cloning
Probíhá načítání komponenty
121 položek
Long PCR Enzyme Mix
A unique enzyme blend for long and tricky PCR applications.
13 503,60 Kč
Cena bez DPH 11 160,00 Kč
do týdne
M13/pUC Reverse Sequencing Primer (-26), 17-mer
5'-d(CAGGAAACAGCTATGAC)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19-based cloning vectors.
1 485,88 Kč
Cena bez DPH 1 228,00 Kč
do týdne
M13/pUC Reverse Sequencing Primer (-46), 24-mer
5'-d(GAGCGGATAACAATTTCACACAGG)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
1 510,08 Kč
Cena bez DPH 1 248,00 Kč
do týdne
M13/pUC Sequencing Primer (-20), 17-mer
5'-d(GTAAAACGACGGCCAGT)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.
1 485,88 Kč
Cena bez DPH 1 228,00 Kč
Skladem
M13/pUC Sequencing Primer (-40), 17-mer
5'-d(GTTTTCCCAGTCACGAC)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
1 495,56 Kč
Cena bez DPH 1 236,00 Kč
do týdne
M13/pUC Sequencing Primer (-46), 22-mer
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
1 485,88 Kč
Cena bez DPH 1 228,00 Kč
do týdne
O’GeneRuler™ 1 kb DNA Ladder, ready-to-use
1 kb DNA ladder for sizing and approximate quantification of a wide range of double-stranded DNA on agarose gels. The ladder is premixed with blue and yellow tracking dyes.
5 100,15 Kč
Cena bez DPH 4 215,00 Kč
do týdne
O’GeneRuler™ DNA Ladder Mix, ready-to-use
DNA ladder for sizing and approximate quantification of a wide range of double-stranded DNA on agarose gels. The ladder is premixed with blue and yellow tracking dyes.
5 045,70 Kč
Cena bez DPH 4 170,00 Kč
do týdne
Oligo(dT)18 Primer
Random Hexamer Primer, Oligo(dT)18 Primer, Anchored Oligo dT Primer
3 121,80 Kč
Cena bez DPH 2 580,00 Kč
do týdne
Oligo(dT)18 Primer
Random Hexamer Primer, Oligo(dT)18 Primer, Anchored Oligo dT Primer
2 417,58 Kč
Cena bez DPH 1 998,00 Kč
do týdne
pBR322 DNA
pBR322 DNA is a 4361 bp double-stranded closed circular medium copy plasmid DNA commonly used for cloning.
3 025,00 Kč
Cena bez DPH 2 500,00 Kč
do týdne
PCR Master Mix (2X)
Highly thermostable DNA polymerase for routine PCR.
15 403,30 Kč
Cena bez DPH 12 730,00 Kč
do týdne