Reaction set up
Probíhá načítání komponenty
30 položek
dNTP Set, 100 mM Solutions
do týdne
47 456,20 Kč
39 220,00 Kč bez DPH
dNTP set – aqueous solutions of dATP, dTTP, dCTP and dGTP supplied in separate ...
T3 promoter Sequencing Primer, 24-mer
do týdne
1 510,08 Kč
1 248,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
dNTP Set, 100 mM Solutions
do týdne
4 392,30 Kč
3 630,00 Kč bez DPH
dNTP set – aqueous solutions of dATP, dTTP, dCTP and dGTP supplied in separate ...
dNTP Mix, 10 mM each
do týdne
3 575,55 Kč
2 955,00 Kč bez DPH
dNTP mixes – premixed aqueous solutions of dATP, dTTP, dCTP, and dGTP.
dNTP Mix, 10 mM each
do týdne
14 616,80 Kč
12 080,00 Kč bez DPH
dNTP mixes – premixed aqueous solutions of dATP, dTTP, dCTP, and dGTP.
Water, nuclease-free
do týdne
941,38 Kč
778,00 Kč bez DPH
Deionized and 0.22 µm membrane-filtered nuclease-free water.
M13/pUC Sequencing Primer (-20), 17-mer
Skladem
1 485,88 Kč
1 228,00 Kč bez DPH
5'-d(GTAAAACGACGGCCAGT)-3'
M13 pUC sequencing primers are single-stranded oligonucle...
dNTP Mix, 10 mM each
do týdne
955,90 Kč
790,00 Kč bez DPH
dNTP mixes – premixed aqueous solutions of dATP, dTTP, dCTP, and dGTP
M13/pUC Sequencing Primer (-46), 22-mer
do týdne
1 485,88 Kč
1 228,00 Kč bez DPH
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'
M13 pUC sequencing primers are single-stranded olig...
dNTP Mix, 2 mM each
do týdne
3 660,25 Kč
3 025,00 Kč bez DPH
dNTP mixes – premixed aqueous solutions of dATP, dTTP, dCTP, and dGTP.
M13/pUC Reverse Sequencing Primer (-46),...
do týdne
1 510,08 Kč
1 248,00 Kč bez DPH
5'-d(GAGCGGATAACAATTTCACACAGG)-3'
M13 pUC sequencing primers are single-st...
Water, nuclease-free
do týdne
1 570,58 Kč
1 298,00 Kč bez DPH
Deionized and 0.22 µm membrane-filtered nuclease-free water.