PCR, qPCR, RT-PCR & dNTPs
Probíhá načítání komponenty
277 položek
M13/pUC Reverse Sequencing Primer (-46),...
do týdne
1 510,08 Kč
1 248,00 Kč bez DPH
5'-d(GAGCGGATAACAATTTCACACAGG)-3'
M13 pUC sequencing primers are single-st...
T3 promoter Sequencing Primer, 24-mer
do týdne
1 510,08 Kč
1 248,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
SP6 promoter Sequencing Primer, 18-mer
do týdne
1 512,50 Kč
1 250,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
dGTP, 100 mM Solution
do týdne
1 536,70 Kč
1 270,00 Kč bez DPH
Formula: C10H13N5O13P3Na3, Molecular weight: 573.2 (acid form: 507.2)
Extremely pure...
dCTP, 100 mM Solution
do týdne
1 539,12 Kč
1 272,00 Kč bez DPH
Formula: C9H13N3O13P3Na3, Molecular weight: 533.1 (acid form: 467.1)
Extre...
dATP, 100 mM Solution
do týdne
1 546,38 Kč
1 278,00 Kč bez DPH
Formula: C10H13N5O12P3Na3, Molecular weight: 557.2 (acid form: 491.2)
Extremely pure...
dTTP, 100 mM Solution
do týdne
1 548,80 Kč
1 280,00 Kč bez DPH
Formula: C10H14N2O14P3Na3, Molecular weight: 548.1 (acid form: 482.1)
Extremely pu...
Water, nuclease-free
do týdne
1 570,58 Kč
1 298,00 Kč bez DPH
Deionized and 0.22 µm membrane-filtered nuclease-free water.
DreamTaq Green DNA Polymerase
do týdne
1 602,04 Kč
1 324,00 Kč bez DPH
Enhanced Taq DNA polymerase supplied with colored buffer enabling direct gel loading ...
DreamTaq DNA Polymerase
do týdne
1 602,04 Kč
1 324,00 Kč bez DPH
Enhanced Taq DNA polymerase optimized for all standard PCR applications ensur...
dUTP, 100 mM Solution
do týdne
1 611,72 Kč
1 332,00 Kč bez DPH
Formula: C9H12N2O14P3Na3, Molecular weight: 534.1 (acid form: 468.1)
Extremely pure ...
T4 DNA Polymerase
do týdne
1 652,86 Kč
1 366,00 Kč bez DPH
.
B buffer for 100% activity FastDigest buffer for 100% activity G bu...