Life Technologies / Fermentas

Probíhá načítání komponenty

Obrázkový výpis Tabulkový výpis Řádkový výpis

1549 položek

Lysis Buffer for MagJET Viral Kit

2 088,46 Kč Cena bez DPH 1 726,00 Kč

do týdne

Lysis Solution (from GeneJET™ Plasmid Miniprep Kit)

The GeneJET Plasmid Miniprep Kit is a simple, rapid, and cost-effective system for the isolation of high quality plasmid DNA from recombinant E. coli cultures.

1 744,82 Kč Cena bez DPH 1 442,00 Kč

do týdne

M13/pUC Reverse Sequencing Primer (-26), 17-mer

5'-d(CAGGAAACAGCTATGAC)-3' M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19-based cloning vectors.

1 485,88 Kč Cena bez DPH 1 228,00 Kč

do týdne

M13/pUC Reverse Sequencing Primer (-46), 24-mer

5'-d(GAGCGGATAACAATTTCACACAGG)-3' M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.

1 510,08 Kč Cena bez DPH 1 248,00 Kč

do týdne

M13/pUC Sequencing Primer (-20), 17-mer

5'-d(GTAAAACGACGGCCAGT)-3' M13 pUC sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.

1 485,88 Kč Cena bez DPH 1 228,00 Kč

Skladem

M13/pUC Sequencing Primer (-40), 17-mer

5'-d(GTTTTCCCAGTCACGAC)-3' M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.

1 495,56 Kč Cena bez DPH 1 236,00 Kč

do týdne

M13/pUC Sequencing Primer (-46), 22-mer

5'-d(GCCAGGGTTTTCCCAGTCACGA)-3' M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.

1 485,88 Kč Cena bez DPH 1 228,00 Kč

do týdne

MagJET NGS Cleanup and Size Selection Kit

.Purify and recover selected sizes of your DNA fragment library from upstream reactions for next-gen sequencing workflows with MagJET NGS Cleanup and Size Kits

22 627,00 Kč Cena bez DPH 18 700,00 Kč

do týdne

MagJET NGS Cleanup and Size Selection Kit

Purify and recover selected sizes of your DNA fragment library from upstream reactions for next-gen sequencing workflows with MagJET NGS Cleanup and Size Kits .

51 933,20 Kč Cena bez DPH 42 920,00 Kč

do týdne

MagJET NGS Cleanup and Size Selection Kit

Purify and recover selected sizes of your DNA fragment library from upstream reactions for next-gen sequencing workflows with MagJET NGS Cleanup and Size Kits

1 241,46 Kč Cena bez DPH 1 026,00 Kč

do týdne

MagJET NGS Cleanup and Size Selection Kit

Purify and recover selected sizes of your DNA fragment library from upstream reactions for next-gen sequencing workflows with MagJET NGS Cleanup and Size Kits

6 969,60 Kč Cena bez DPH 5 760,00 Kč

do týdne

MagJET Plasmid DNA Kit

Purifies plasmid DNA from overnight E. coli cultures using paramagnetic bead technology.

5 886,65 Kč Cena bez DPH 4 865,00 Kč

do týdne