Na našich webových stránkách používáme soubory cookies. Některé z nich jsou nezbytné, zatímco jiné nám pomáhají vylepšit tento web a váš uživatelský zážitek. Souhlasíte s používáním všech cookies?
Cookies nastavení
Vaše soukromí je důležité. Můžete si vybrat nastavení cookies níže.
The GeneJET Plasmid Miniprep Kit is a simple, rapid, and cost-effective system for the isolation of high quality plasmid DNA from recombinant E. coli cultures.
5'-d(CAGGAAACAGCTATGAC)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19-based cloning vectors.
5'-d(GAGCGGATAACAATTTCACACAGG)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
5'-d(GTTTTCCCAGTCACGAC)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
.Purify and recover selected sizes of your DNA fragment library from upstream reactions for next-gen sequencing workflows with MagJET NGS Cleanup and Size Kits
Purify and recover selected sizes of your DNA fragment library from upstream reactions for next-gen sequencing workflows with MagJET NGS Cleanup and Size Kits .
Purify and recover selected sizes of your DNA fragment library from upstream reactions for next-gen sequencing workflows with MagJET NGS Cleanup and Size Kits
Purify and recover selected sizes of your DNA fragment library from upstream reactions for next-gen sequencing workflows with MagJET NGS Cleanup and Size Kits