Tento e-shop využívá cookies

Na našich webových stránkách používáme soubory cookies. Některé z nich jsou nezbytné, zatímco jiné nám pomáhají vylepšit tento web a váš uživatelský zážitek. Souhlasíte s používáním všech cookies?

Cookies nastavení

Vaše soukromí je důležité. Můžete si vybrat nastavení cookies níže.

Reaction set up


Probíhá načítání komponenty
T7 promoter Sequencing Primer, 20-mer

T7 promoter Sequencing Primer, 20-mer

do týdne
1 478,62 Kč
1 222,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
dNTP Set, 100 mM Solutions

dNTP Set, 100 mM Solutions

do týdne
47 456,20 Kč
39 220,00 Kč bez DPH
dNTP set – aqueous solutions of dATP, dTTP, dCTP and dGTP supplied in separate ...
T3 promoter Sequencing Primer, 24-mer

T3 promoter Sequencing Primer, 24-mer

do týdne
1 510,08 Kč
1 248,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
dNTP Set, 100 mM Solutions

dNTP Set, 100 mM Solutions

do týdne
4 392,30 Kč
3 630,00 Kč bez DPH
dNTP set – aqueous solutions of dATP, dTTP, dCTP and dGTP supplied in separate ...
dNTP Mix, 10 mM each

dNTP Mix, 10 mM each

do týdne
3 575,55 Kč
2 955,00 Kč bez DPH
1 mL
dNTP mixes – premixed aqueous solutions of dATP, dTTP, dCTP, and dGTP.
dNTP Mix, 10 mM each

dNTP Mix, 10 mM each

do týdne
14 616,80 Kč
12 080,00 Kč bez DPH
5 x 1.0 mL
dNTP mixes – premixed aqueous solutions of dATP, dTTP, dCTP, and dGTP.
Water, nuclease-free

Water, nuclease-free

do týdne
941,38 Kč
778,00 Kč bez DPH
Deionized and 0.22 µm membrane-filtered nuclease-free water.
dNTP Mix, 10 mM each

dNTP Mix, 10 mM each

do týdne
955,90 Kč
790,00 Kč bez DPH
0.2 ml
dNTP mixes – premixed aqueous solutions of dATP, dTTP, dCTP, and dGTP
M13/pUC Sequencing Primer (-46), 22-mer

M13/pUC Sequencing Primer (-46), 22-mer

do týdne
1 485,88 Kč
1 228,00 Kč bez DPH
0.1 AU
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3' M13 pUC sequencing primers are single-stranded olig...
dNTP Mix, 2 mM each

dNTP Mix, 2 mM each

do týdne
3 660,25 Kč
3 025,00 Kč bez DPH
dNTP mixes – premixed aqueous solutions of dATP, dTTP, dCTP, and dGTP.
M13/pUC Reverse Sequencing Primer (-46), 24-mer

M13/pUC Reverse Sequencing Primer (-46),...

do týdne
1 510,08 Kč
1 248,00 Kč bez DPH
0.1 AU
5'-d(GAGCGGATAACAATTTCACACAGG)-3' M13 pUC sequencing primers are single-st...
Water, nuclease-free

Water, nuclease-free

do týdne
1 570,58 Kč
1 298,00 Kč bez DPH
30 ml
Deionized and 0.22 µm membrane-filtered nuclease-free water.