Life Technologies / Fermentas
Probíhá načítání komponenty
1137 položek
M13/pUC Sequencing Primer (-40), 17-mer
do týdne
1 495,56 Kč
1 236,00 Kč bez DPH
5'-d(GTTTTCCCAGTCACGAC)-3'
M13 pUC sequencing primers are single-stranded oligonucl...
M13/pUC Sequencing Primer (-46), 22-mer
do týdne
1 485,88 Kč
1 228,00 Kč bez DPH
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'
M13 pUC sequencing primers are single-stranded olig...
MagJET NGS Cleanup and Size Selection Ki...
do týdne
6 969,60 Kč
5 760,00 Kč bez DPH
Purify and recover selected sizes of your DNA fragment library from upstream reacti...
MagJET NGS Cleanup and Size Selection Ki...
do týdne
51 933,20 Kč
42 920,00 Kč bez DPH
Purify and recover selected sizes of your DNA fragment library from upstream reaction...
MagJET NGS Cleanup and Size Selection Ki...
do týdne
22 627,00 Kč
18 700,00 Kč bez DPH
.Purify and recover selected sizes of your DNA fragment library from upstream reactio...
MagJET NGS Cleanup and Size Selection Ki...
do týdne
1 241,46 Kč
1 026,00 Kč bez DPH
Purify and recover selected sizes of your DNA fragment library from upstream reaction...
MagJET Plasmid DNA Kit
do týdne
5 886,65 Kč
4 865,00 Kč bez DPH
Purifies plasmid DNA from overnight E. coli cultures using paramagnetic bead technolo...
MagJET Plasmid DNA Kit
do týdne
20 703,10 Kč
17 110,00 Kč bez DPH
.
Purifies plasmid DNA from overnight E. coli cultures using paramagnetic bead tec...
MagJET Rack, 12x1.5 mL
do týdne
13 673,00 Kč
11 300,00 Kč bez DPH
. The MagJET separation rack allows fast and efficient procedures for magnetic ...
MagJET Rack, 2x1.5 mL
do týdne
5 674,90 Kč
4 690,00 Kč bez DPH
The MagJET separation rack allows fast and efficient procedures for magnetic bead-ba...
