Na našich webových stránkách používáme soubory cookies. Některé z nich jsou nezbytné, zatímco jiné nám pomáhají vylepšit tento web a váš uživatelský zážitek. Souhlasíte s používáním všech cookies?
Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .
Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .
Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .
Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .
Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .
. Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color.
Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .
Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color.
.
Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .
5'-d(CAGGAAACAGCTATGAC)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19-based cloning vectors.
5'-d(GAGCGGATAACAATTTCACACAGG)-3'
M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.