PCR, qPCR, RT-PCR & dNTPs

Probíhá načítání komponenty

Obrázkový výpis Tabulkový výpis Řádkový výpis

277 položek

Luminaris Probe High ROX qPCR Master Mix

Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .

31 278,50 Kč Cena bez DPH 25 850,00 Kč

do týdne

Luminaris Probe Low ROX qPCR Master Mix

Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .

30 165,30 Kč Cena bez DPH 24 930,00 Kč

do týdne

Luminaris Probe Low ROX qPCR Master Mix

Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .

6 800,20 Kč Cena bez DPH 5 620,00 Kč

do týdne

Luminaris Probe Low ROX qPCR Master Mix

Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .

12 813,90 Kč Cena bez DPH 10 590,00 Kč

do týdne

Luminaris Probe Low ROX qPCR Master Mix

Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .

100 551,00 Kč Cena bez DPH 83 100,00 Kč

do týdne

Luminaris Probe qPCR Master Mix

. Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color.

6 824,40 Kč Cena bez DPH 5 640,00 Kč

do týdne

Luminaris Probe qPCR Master Mix

Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .

31 629,40 Kč Cena bez DPH 26 140,00 Kč

do týdne

Luminaris Probe qPCR Master Mix

Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .

100 067,00 Kč Cena bez DPH 82 700,00 Kč

do týdne

Luminaris Probe qPCR Master Mix

Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. .

13 164,80 Kč Cena bez DPH 10 880,00 Kč

do týdne

M13/pUC Reverse Sequencing Primer (-26), 17-mer

5'-d(CAGGAAACAGCTATGAC)-3' M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19-based cloning vectors.

1 485,88 Kč Cena bez DPH 1 228,00 Kč

do týdne

M13/pUC Reverse Sequencing Primer (-46), 24-mer

5'-d(GAGCGGATAACAATTTCACACAGG)-3' M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.

1 510,08 Kč Cena bez DPH 1 248,00 Kč

do týdne

M13/pUC Sequencing Primer (-20), 17-mer

5'-d(GTAAAACGACGGCCAGT)-3' M13 pUC sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.

1 485,88 Kč Cena bez DPH 1 228,00 Kč

Skladem