Tento e-shop využívá cookies

Na našich webových stránkách používáme soubory cookies. Některé z nich jsou nezbytné, zatímco jiné nám pomáhají vylepšit tento web a váš uživatelský zážitek. Souhlasíte s používáním všech cookies?

Nastavení Jen nezbytné Souhlasím
Cookies nastavení

Vaše soukromí je důležité. Můžete si vybrat nastavení cookies níže.

Potvrzuji
  1. Úvodní strana
  2. Reagencie
  3. Life Technologies / Fermentas
  4. PCR, qPCR, RT-PCR & dNTPs

PCR, qPCR, RT-PCR & dNTPs


Probíhá načítání komponenty
Obrázkový výpis Tabulkový výpis Řádkový výpis
277 položek
M13/pUC Sequencing Primer (-40), 17-mer
M13/pUC Sequencing Primer (-40), 17-mer
5'-d(GTTTTCCCAGTCACGAC)-3' M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
1 495,56 Kč Cena bez DPH 1 236,00 Kč
0.1 AU
do týdne
M13/pUC Sequencing Primer (-46), 22-mer
M13/pUC Sequencing Primer (-46), 22-mer
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3' M13 pUC sequencing primers are single-stranded oligonucleotides used for sequencing of DNA fragments inserted into the MCS of various pUC19 based cloning vectors.
1 485,88 Kč Cena bez DPH 1 228,00 Kč
0.1 AU
do týdne
MagJET Rack, 12x1.5 mL
MagJET Rack, 12x1.5 mL
. The MagJET separation rack allows fast and efficient procedures for magnetic bead-based nucleic acid isolation and affinity purification workflows.
13 673,00 Kč Cena bez DPH 11 300,00 Kč
do týdne
MagJET Rack, 2x1.5 mL
MagJET Rack, 2x1.5 mL
The MagJET separation rack allows fast and efficient procedures for magnetic bead-based nucleic acid isolation and affinity purification workflows.
5 674,90 Kč Cena bez DPH 4 690,00 Kč
2 x 1.5 mL
do týdne
MagJET Rack, 4x50 mL
MagJET Rack, 4x50 mL
11 240,90 Kč Cena bez DPH 9 290,00 Kč
1 each
do týdne
MagJET Separation Rack, x96
MagJET Separation Rack, x96
.
17 944,30 Kč Cena bez DPH 14 830,00 Kč
1 each
do týdne
Maxima cDNA Kit with dsDNase
Maxima cDNA Kit with dsDNase
Complete system for efficient synthesis of first strand cDNA.
47 093,20 Kč Cena bez DPH 38 920,00 Kč
do týdne
Maxima cDNA Kit with dsDNase
Maxima cDNA Kit with dsDNase
Complete system for efficient synthesis of first strand cDNA.
14 810,40 Kč Cena bez DPH 12 240,00 Kč
50 rxn kit
do týdne
Maxima First Strand cDNA Synthesis Kit for RT-qPCR
Maxima First Strand cDNA Synthesis Kit for RT-qPCR
Complete system for efficient synthesis of first strand cDNA.
40 801,20 Kč Cena bez DPH 33 720,00 Kč
200 rxns
do týdne
Maxima First Strand cDNA Synthesis Kit for RT-qPCR
Maxima First Strand cDNA Synthesis Kit for RT-qPCR
Complete system for efficient synthesis of first strand cDNA.
13 043,80 Kč Cena bez DPH 10 780,00 Kč
50 rxns
do týdne
Maxima H Minus First Strand cDNA Synthesis Kit
Maxima H Minus First Strand cDNA Synthesis Kit
A complete system for highly efficient synthesis of first strand cDNA.
5 227,20 Kč Cena bez DPH 4 320,00 Kč
do týdne
Maxima H Minus First Strand cDNA Synthesis Kit
Maxima H Minus First Strand cDNA Synthesis Kit
  A complete system for highly efficient synthesis of first strand cDNA.
21 586,40 Kč Cena bez DPH 17 840,00 Kč
do týdne