T3 RNA Polymerase, HC
.
High concentration available Recombinant enzyme Thermal inactivation at 70°C in 10 min
T3 RNA polymerase is DNA-dependent RNA polymerase catalyzes the 5'→3' synthesis of RNA on either single-stranded or double-stranded DNA under control of the T3 promoter
Detailní popis
Thermo Scientific Bacteriophage T3 RNA polymerase is DNA-dependent RNA polymerase with strict specificity for their respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter and is able to incorporate modified nucleotide.
Highlights
- Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)
Applications
- Synthesis of unlabeled and labeled RNA that can be used:
- For hybridization (see Reference 1), in vitro RNA translation (see Reference 2)
- As aRNA (see Reference 3), siRNA (see Reference 4), substrate in RNase protection assays (see Reference 5), template for genomic DNA sequencing (see Reference 6)
- In studies of RNA secondary structure and RNA-protein interactions (see Reference 7), RNA splicing (see Reference 8)
Note
Consensus promoter sequences:
T3 | AATTAACCCTCACTAAAGGGAGA |
---|---|
T7 | TAATACGACTCACTATAGGGAGA |
SP6 | ATTTAGGTGACACTATAGAAGNG |
The position in bold (+1) indicates the first nucleotide incorporated into RNA during transcription. Only bases at this position through +3 are critical for transcription, and they must be a G and a purine base, respectively (see Reference 9).
5X Transcription Buffer | 200 mM Tris-HCl (pH 7.9 at 25°C), 30 mM MgCl2, 50 mM DTT, 50 mM NaCl, 10 mM spermidine. |
CategoryName | |
Definition of Activity Unit |
|
Hazardous | No |
Hazardous: | No |
Inactivation | Inactivated by heating at 70°C for 10 min or by addition of EDTA. |
Inhibition | Inhibitors: metal chelators, enzyme activity is reduced by 50% at NaCl or KCl concentration above 250 mM. Greater than 50% reduction in enzyme activity with ammonium sulphate. |
Molecular Weight | 99 kDa monomer |
Quality Control |
|
Shelf Life: | |
Shipping Condition: | |
Shipping Information | |
Source | E. coli cells with a cloned gene encoding T3 RNA polymerase. |
SpecificationName | |
SpecificationValue | |
Storage Buffer | Polymerase is supplied in 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 5 mM DTT, 0.1 mg/mL BSA, 0.03% (v/v) ELUGENT Detergent, 50% (v/v) glycerol. |
Storage Condition | -20 C |
Storage Condition: |
Hodnocení produktu
Produkt zatím nikdo nehodnotil, buďte první!