Primers - UAB Fermentas


Probíhá načítání komponenty
SP6 promoter Sequencing Primer, 24-mer

SP6 promoter Sequencing Primer, 24-mer

do týdne
1 231,78 Kč
1 018,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T7 promoter Sequencing Primer, 20-mer

T7 promoter Sequencing Primer, 20-mer

do týdne
1 231,78 Kč
1 018,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T3 promoter Sequencing Primer, 17-mer

T3 promoter Sequencing Primer, 17-mer

do týdne
1 236,62 Kč
1 022,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
M13/pUC Sequencing Primer (-46), 22-mer

M13/pUC Sequencing Primer (-46), 22-mer

do týdne
1 236,62 Kč
1 022,00 Kč bez DPH
0.1 AU
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3' M13 pUC sequencing primers are single-stranded olig...
M13/pUC Reverse Sequencing Primer (-26), 17-mer

M13/pUC Reverse Sequencing Primer (-26),...

Skladem
1 246,30 Kč
1 030,00 Kč bez DPH
0.1 AU
5'-d(CAGGAAACAGCTATGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
M13/pUC Sequencing Primer (-20), 17-mer

M13/pUC Sequencing Primer (-20), 17-mer

Skladem
1 246,30 Kč
1 030,00 Kč bez DPH
0.1 AU
5'-d(GTAAAACGACGGCCAGT)-3' M13 pUC sequencing primers are single-stranded oligonucle...
M13/pUC Sequencing Primer (-40), 17-mer

M13/pUC Sequencing Primer (-40), 17-mer

do týdne
1 246,30 Kč
1 030,00 Kč bez DPH
0.1 AU
5'-d(GTTTTCCCAGTCACGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
SP6 promoter Sequencing Primer, 18-mer

SP6 promoter Sequencing Primer, 18-mer

do týdne
1 251,14 Kč
1 034,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T3 promoter Sequencing Primer, 24-mer

T3 promoter Sequencing Primer, 24-mer

do týdne
1 258,40 Kč
1 040,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
M13/pUC Reverse Sequencing Primer (-46), 24-mer

M13/pUC Reverse Sequencing Primer (-46),...

do týdne
1 258,40 Kč
1 040,00 Kč bez DPH
0.1 AU
5'-d(GAGCGGATAACAATTTCACACAGG)-3' M13 pUC sequencing primers are single-st...
Lambda DNA

Lambda DNA

do týdne
1 703,68 Kč
1 408,00 Kč bez DPH
500 µg
Lambda DNA is a common substrate for restriction endonucleases and for generati...
Lambda DNA (dam–, dcm–)

Lambda DNA (dam–, dcm–)

do týdne
1 752,08 Kč
1 448,00 Kč bez DPH
500 µg
Lambda DNA is a common substrate for restriction endonucleases and for generati...