Primers

 Za nukleotidy můžeme považovat základní jednotky molekul nukleových kyselin, které se liší obsahem dusíkatých bází a schopností tvořit vodíkové vazby. Molekuly nukleových kyselin mohou být jednořetězcové (RNA) nebo dvouřetězcové (DNA). Vznikají činností polymeráz, které jako stavební kameny používají nukleosidtrifosfáty. Spojovací molekulou řetězců jsou zbytky pentóz, které svými vazbami určují směr 5´"3´.

Meziřetězcové vodíkové vazby mezi bázemi vznikají podle pravidla párování A-T, C-G a pro vznik dvouřetězcové molekuly je typické antiparalení uložení řetězců. Vodíkové vazby lze zrušit (denaturace) zvýšením teploty (nad 900C) iontovou silou a změnou pH. Po návratu k původním hodnotám se vodíkové vazby znovu vytvoří (hybridizace, annealing).

Krátké sekvence nukleotidů lze použít jako priméry tedy startovní místo pro polymerázy, nebo jako sondy – vyhledání komplementárních úseků v analyzované DNA.


Probíhá načítání komponenty
T3 promoter Sequencing Primer, 17-mer

T3 promoter Sequencing Primer, 17-mer

Skladem
1 161,60 Kč
960,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
M13/pUC Sequencing Primer (-46), 22-mer

M13/pUC Sequencing Primer (-46), 22-mer

Skladem
1 161,60 Kč
960,00 Kč bez DPH
0.1 AU
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3' M13 pUC sequencing primers are single-stranded olig...
SP6 promoter Sequencing Primer, 24-mer

SP6 promoter Sequencing Primer, 24-mer

Skladem
1 168,86 Kč
966,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T7 promoter Sequencing Primer, 20-mer

T7 promoter Sequencing Primer, 20-mer

Skladem
1 168,86 Kč
966,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
SP6 promoter Sequencing Primer, 18-mer

SP6 promoter Sequencing Primer, 18-mer

Skladem
1 176,12 Kč
972,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T3 promoter Sequencing Primer, 24-mer

T3 promoter Sequencing Primer, 24-mer

Skladem
1 180,96 Kč
976,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
M13/pUC Reverse Sequencing Primer (-46), 24-mer

M13/pUC Reverse Sequencing Primer (-46),...

Skladem
1 180,96 Kč
976,00 Kč bez DPH
0.1 AU
5'-d(GAGCGGATAACAATTTCACACAGG)-3' M13 pUC sequencing primers are single-st...
M13/pUC Reverse Sequencing Primer (-26), 17-mer

M13/pUC Reverse Sequencing Primer (-26),...

Skladem
1 183,38 Kč
978,00 Kč bez DPH
0.1 AU
5'-d(CAGGAAACAGCTATGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
M13/pUC Sequencing Primer (-20), 17-mer

M13/pUC Sequencing Primer (-20), 17-mer

Skladem
1 183,38 Kč
978,00 Kč bez DPH
0.1 AU
5'-d(GTAAAACGACGGCCAGT)-3' M13 pUC sequencing primers are single-stranded oligonucle...
M13/pUC Sequencing Primer (-40), 17-mer

M13/pUC Sequencing Primer (-40), 17-mer

Skladem
1 183,38 Kč
978,00 Kč bez DPH
0.1 AU
5'-d(GTTTTCCCAGTCACGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
Random Hexamer

Random Hexamer

Skladem
1 420,54 Kč
1 174,00 Kč bez DPH
120 µL
Random Hexamer Primer, Oligo(dT)18 Primer, Anchored Oligo dT Primer
Lambda DNA

Lambda DNA

Skladem
1 592,36 Kč
1 316,00 Kč bez DPH
500 µg
Lambda DNA is a common substrate for restriction endonucleases and for generati...