First Strand cDNA Synthesis Kit
A complete system for the efficient synthesis of first strand cDNA from RNA templates.
Detailní popis
Thermo Scientific First Strand cDNA Synthesis kit utilizes the recombinant M-MuLV Reverse Transcriptase which exhibits lower RNase H activity than AMV reverse transcriptase. Due to this feature, full-length cDNA can be synthesized from RNA templates up to 9 kb. The recombinant RiboLock RNase Inhibitor, supplied with the kit effectively protects RNA template from degradation.
The first strand of cDNA can be directly used as a template in PCR or in second strand cDNA synthesis.
Highlights
- Efficient synthesis of first strand cDNA up to 9 kb
- Reaction temperature 37°C
- Supplied with the recombinant RiboLock RNase Inhibitor
- Complete – oligo(dT)18 and random hexamer primers included with the kit
Applications
- First strand cDNA synthesis for RT-PCR and real-time RT-PCR
- Construction of cDNA libraries
- Generation of probes for hybridization
- aRNA synthesis
Includes
- M-MuLV Reverse Transcriptase
- RiboLock RNase Inhibitor
- 5X Reaction Buffer
- dNTP Mix, 10 mM each
- Oligo(dT)18 Primer
- Random Hexamer Primer
- Control GAPDH RNA
- Forward GAPDH Primer, 10 µM (5'-
CAAGGTCATCCATGACAACTTTG
-3') - Reverse GAPDH Primer, 10 µM (5'-
GTCCACCACCCTGTTGCTGTAG
-3') - Water, nuclease free
The kit is supplied with both oligo(dT)18 and random hexamer primers. The oligo(dT)18 anneals selectively on the poly(A) tail of mRNA. Random hexamer primers do not require the presence of poly(A). Therefore, they can be used for transcription of the 5'-end regions of mRNA or cDNA synthesis using RNA without poly(A) tail e.g. micro RNAs. Gene-specific primers may also be used with the kits.
Hazardous | No |
Storage Condition | -20 C |
Obsah balení
100 x 20 µL rxns
Hodnocení produktu
Produkt zatím nikdo nehodnotil, buďte první!