Tento e-shop využívá cookies

Na našich webových stránkách používáme soubory cookies. Některé z nich jsou nezbytné, zatímco jiné nám pomáhají vylepšit tento web a váš uživatelský zážitek. Souhlasíte s používáním všech cookies?

Cookies nastavení

Vaše soukromí je důležité. Můžete si vybrat nastavení cookies níže.

T7 RNA Polymerase, HC

Kód produktu: EP0113 Kód výrobce: EP0113 Kód dodavatele: {28CBED62-B55E-462B-8468-C82B5404C039} Výrobce: UAB Fermentas
na dotaz

. T7 RNA polymerase is DNA-dependent RNA polymerase catalyzes the 5'=>3' synthesis of RNA on either single-stranded or double-stranded DNA under control of the T7 promoter.

Zobraz detailní popis

Detailní popis

Thermo Scientific Bacteriophage T7 RNA polymerase is DNA-dependent RNA polymerase with strict specificity for their respective double-stranded promoters. It catalyzes the 5'=>3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.

Highlights

  • Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

Synthesis of unlabeled and labeled RNA that can be used:

  • For hybridization (see Reference 1), in vitro RNA translation (see​ Reference 2)
  • As aRNA (see​ Reference 3), siRNA (see​ Reference 4), substrate in RNase protection assays (see​ Reference 5), template for genomic DNA sequencing (see​ Reference 6)
  • In studies of RNA secondary structure and RNA-protein interactions (see​ Reference 7), RNA splicing (see​ Reference 8)

Note

Consensus promoter sequences:

T3 AATTAACCCTCACTAAAGGGAGA 
T7 TAATACGACTCACTATAGGGAGA 
SP6 ATTTAGGTGACACTATAGAAGNG 

The position in bold (+1) indicates the first nucleotide incorporated into RNA during transcription. Only bases at this position through +3  are critical for transcription, and they must be a G and a purine base, respectively (see​ Reference 9).

5X Transcription Buffer 200 mM Tris-HCl (pH 7.9 at 25°C), 30 mM MgCl2, 50 mM DTT, 50 mM NaCl, 10 mM spermidine.
Definition of Activity Unit
  • One unit of the enzyme incorporates 1 nmol of AMP into a polynucleotide fraction (adsorbed on DE-81) in 60 min at 37°C.
  • Enzyme activity is assayed in the following mixture: 40 mM Tris-HCl (pH 8.0), 6 mM MgCl2, 10 mM DTT, 2 mM spermidine, 0.5 mM of each NTP, 0.6 MBq/mL [3H]-ATP, 20 µg/mL plasmid DNA containing the appropriate promoter sequences.
Hazardous No
Inactivation Inactivated by heating at 70°C for 10 min or by addition of EDTA.
Inhibition and Activation Inhibitors: metal chelators, enzyme activity is reduced by 50% at NaCl or KCl concentration above 150 mM. Greater than 50% reduction in enzyme activity with ammonium sulphate.
Molecular Weight 99 kDa monomer
Quality Control
  • The absence of endo-, exodeoxyribonucleases and ribonucleases confirmed by appropriate tests.
  • Functionally tested in in vitro transcription reaction.
Source E. coli cells with a cloned gene encoding T7 RNA polymerase.
Storage Buffer Polymerase is supplied in: 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 5 mM DTT, 0.1 mg/mL BSA, 0.03% (v/v) ELUGENT Detergent, 50% (v/v) glycerol.
Storage Condition -20 C

Hodnocení produktu

Produkt zatím nikdo nehodnotil, buďte první!