T7 promoter Sequencing Primer, 20-mer

Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II Detailní informace

Cena s DPH 1 168,86 Kč
Cena bez DPH 966,00 Kč
 0.1 AU
Dostupnost Do týdne skladem
Kód produktu SO118

Detailní popis T7 promoter Sequencing Primer, 20-mer

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the SP6, T3, or T7 RNA polymerase promoter regions respectively. Primers are supplied as 10 µM aqueous solutions.


  • Sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control

Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog Promoter sequence
SO116 SP6 promoter sequencing primer, 18-mer 5'-d (ATTTAGGTGACACTATAG)-3' 
SO117 SP6 promoter sequencing primer, 24-mer 5'-d (CATACGATTTAGGTGACACTATAG)-3' 
SO118 T7 promoter sequencing primer, 20-mer 5'-d (TAATACGACTCACTATAGGG)-3' 
SO119 T3 promoter sequencing primer, 17-mer 5'-d (ATTAACCCTCACTAAAG)-3' 
SO120 T3 promoter sequencing primer, 24-mer 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3' 


Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Hazardous No
Storage Condition -20 C



Novinky za prosinec MRC-Holland

7. leden 2018
Podívejte se, co přinesl poslední měsíc roku 2017 do MRC-Holland. V nejnovějším zpravodaji MLPA vám přinášíme důležité aktuality.

Archiv novinek

FastDirect restrikční enzymy

Moderní linie restrikční enzymy pro rychlé DNA stříhání. Jsou schopné rozstříhat DNA za 5-15 minut.

© 2018, BIOGEN PRAHA s.r.o. – všechna práva vyhrazena

Partneři | Jak nakupovat | Služby | Mapa stránek

eBRÁNA | B2C Brána |

Zobrazit mobilní verzi

Přeskočit na začátek stránky