Sequencing - UAB Fermentas

Probíhá načítání komponenty
SP6 promoter Sequencing Primer, 24-mer

SP6 promoter Sequencing Primer, 24-mer

do týdne
1 231,78 Kč
1 018,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T7 promoter Sequencing Primer, 20-mer

T7 promoter Sequencing Primer, 20-mer

do týdne
1 231,78 Kč
1 018,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T3 promoter Sequencing Primer, 17-mer

T3 promoter Sequencing Primer, 17-mer

do týdne
1 236,62 Kč
1 022,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
M13/pUC Sequencing Primer (-46), 22-mer

M13/pUC Sequencing Primer (-46), 22-mer

do týdne
1 236,62 Kč
1 022,00 Kč bez DPH
0.1 AU
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3' M13 pUC sequencing primers are single-stranded olig...
M13/pUC Reverse Sequencing Primer (-26), 17-mer

M13/pUC Reverse Sequencing Primer (-26),...

1 246,30 Kč
1 030,00 Kč bez DPH
0.1 AU
5'-d(CAGGAAACAGCTATGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
M13/pUC Sequencing Primer (-20), 17-mer

M13/pUC Sequencing Primer (-20), 17-mer

1 246,30 Kč
1 030,00 Kč bez DPH
0.1 AU
5'-d(GTAAAACGACGGCCAGT)-3' M13 pUC sequencing primers are single-stranded oligonucle...
M13/pUC Sequencing Primer (-40), 17-mer

M13/pUC Sequencing Primer (-40), 17-mer

do týdne
1 246,30 Kč
1 030,00 Kč bez DPH
0.1 AU
5'-d(GTTTTCCCAGTCACGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
SP6 promoter Sequencing Primer, 18-mer

SP6 promoter Sequencing Primer, 18-mer

do týdne
1 251,14 Kč
1 034,00 Kč bez DPH
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
M13/pUC Reverse Sequencing Primer (-46), 24-mer

M13/pUC Reverse Sequencing Primer (-46),...

do týdne
1 258,40 Kč
1 040,00 Kč bez DPH
0.1 AU
5'-d(GAGCGGATAACAATTTCACACAGG)-3' M13 pUC sequencing primers are single-st...
pJET1.2 Reverse Sequencing Primer, 24-mer

pJET1.2 Reverse Sequencing Primer, 24-me...

do týdne
1 885,18 Kč
1 558,00 Kč bez DPH
0.2 AU
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR...
pJET1.2 Forward Sequencing Primer, 23-mer

pJET1.2 Forward Sequencing Primer, 23-me...

do týdne
1 885,18 Kč
1 558,00 Kč bez DPH
0.2 AU
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR...
Wash Buff/GeneJET NGS Cleanup

Wash Buff/GeneJET NGS Cleanup

do týdne
2 801,15 Kč
2 315,00 Kč bez DPH
40 ml
Silica micro column based fast DNA fragment cleanup and NGS adapter removal.