Tento e-shop využívá cookies

Na našich webových stránkách používáme soubory cookies. Některé z nich jsou nezbytné, zatímco jiné nám pomáhají vylepšit tento web a váš uživatelský zážitek. Souhlasíte s používáním všech cookies?

Cookies nastavení

Vaše soukromí je důležité. Můžete si vybrat nastavení cookies níže.

Sequencing - Life Technologies Czech Republic s.r.o.

Probíhá načítání komponenty
SP6 promoter Sequencing Primer, 24-mer

SP6 promoter Sequencing Primer, 24-mer

do týdne
1 316,48 Kč
1 088,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T7 promoter Sequencing Primer, 20-mer

T7 promoter Sequencing Primer, 20-mer

do týdne
1 323,74 Kč
1 094,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T3 promoter Sequencing Primer, 17-mer

T3 promoter Sequencing Primer, 17-mer

do týdne
1 326,16 Kč
1 096,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
M13/pUC Sequencing Primer (-46), 22-mer

M13/pUC Sequencing Primer (-46), 22-mer

do týdne
1 331,00 Kč
1 100,00 Kč bez DPH
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3' M13 pUC sequencing primers are single-stranded olig...
M13/pUC Sequencing Primer (-40), 17-mer

M13/pUC Sequencing Primer (-40), 17-mer

do týdne
1 340,68 Kč
1 108,00 Kč bez DPH
5'-d(GTTTTCCCAGTCACGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
M13/pUC Reverse Sequencing Primer (-46), 24-mer

M13/pUC Reverse Sequencing Primer (-46),...

do týdne
1 352,78 Kč
1 118,00 Kč bez DPH
5'-d(GAGCGGATAACAATTTCACACAGG)-3' M13 pUC sequencing primers are single-st...
SP6 promoter Sequencing Primer, 18-mer

SP6 promoter Sequencing Primer, 18-mer

do týdne
1 355,20 Kč
1 120,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
M13/pUC Reverse Sequencing Primer (-26), 17-mer

M13/pUC Reverse Sequencing Primer (-26),...

1 398,76 Kč
1 156,00 Kč bez DPH
5'-d(CAGGAAACAGCTATGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
M13/pUC Sequencing Primer (-20), 17-mer

M13/pUC Sequencing Primer (-20), 17-mer

1 398,76 Kč
1 156,00 Kč bez DPH
5'-d(GTAAAACGACGGCCAGT)-3' M13 pUC sequencing primers are single-stranded oligonucle...
pJET1.2 Reverse Sequencing Primer, 24-mer

pJET1.2 Reverse Sequencing Primer, 24-me...

do týdne
2 025,54 Kč
1 674,00 Kč bez DPH
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR...
pJET1.2 Forward Sequencing Primer, 23-mer

pJET1.2 Forward Sequencing Primer, 23-me...

do týdne
2 027,96 Kč
1 676,00 Kč bez DPH
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR...
MagJET NGS Cleanup and Size Selection Kit

MagJET NGS Cleanup and Size Selection Ki...

do týdne
5 493,40 Kč
4 540,00 Kč bez DPH
Purify and recover selected sizes of your DNA fragment library from upstream reacti...