Tento e-shop využívá cookies

Na našich webových stránkách používáme soubory cookies. Některé z nich jsou nezbytné, zatímco jiné nám pomáhají vylepšit tento web a váš uživatelský zážitek. Souhlasíte s používáním všech cookies?

Cookies nastavení

Vaše soukromí je důležité. Můžete si vybrat nastavení cookies níže.


Probíhá načítání komponenty
SP6 promoter Sequencing Primer, 24-mer

SP6 promoter Sequencing Primer, 24-mer

do týdne
1 316,48 Kč
1 088,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T7 promoter Sequencing Primer, 20-mer

T7 promoter Sequencing Primer, 20-mer

do týdne
1 323,74 Kč
1 094,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
T3 promoter Sequencing Primer, 17-mer

T3 promoter Sequencing Primer, 17-mer

do týdne
1 326,16 Kč
1 096,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
M13/pUC Reverse Sequencing Primer (-26), 17-mer

M13/pUC Reverse Sequencing Primer (-26),...

1 331,00 Kč
1 100,00 Kč bez DPH
5'-d(CAGGAAACAGCTATGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
M13/pUC Sequencing Primer (-20), 17-mer

M13/pUC Sequencing Primer (-20), 17-mer

1 331,00 Kč
1 100,00 Kč bez DPH
5'-d(GTAAAACGACGGCCAGT)-3' M13 pUC sequencing primers are single-stranded oligonucle...
M13/pUC Sequencing Primer (-46), 22-mer

M13/pUC Sequencing Primer (-46), 22-mer

do týdne
1 331,00 Kč
1 100,00 Kč bez DPH
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3' M13 pUC sequencing primers are single-stranded olig...
M13/pUC Sequencing Primer (-40), 17-mer

M13/pUC Sequencing Primer (-40), 17-mer

do týdne
1 340,68 Kč
1 108,00 Kč bez DPH
5'-d(GTTTTCCCAGTCACGAC)-3' M13 pUC sequencing primers are single-stranded oligonucl...
M13/pUC Reverse Sequencing Primer (-46), 24-mer

M13/pUC Reverse Sequencing Primer (-46),...

do týdne
1 352,78 Kč
1 118,00 Kč bez DPH
5'-d(GAGCGGATAACAATTTCACACAGG)-3' M13 pUC sequencing primers are single-st...
SP6 promoter Sequencing Primer, 18-mer

SP6 promoter Sequencing Primer, 18-mer

do týdne
1 355,20 Kč
1 120,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
pJET1.2 Reverse Sequencing Primer, 24-mer

pJET1.2 Reverse Sequencing Primer, 24-me...

do týdne
2 025,54 Kč
1 674,00 Kč bez DPH
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR...
pJET1.2 Forward Sequencing Primer, 23-mer

pJET1.2 Forward Sequencing Primer, 23-me...

do týdne
2 027,96 Kč
1 676,00 Kč bez DPH
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR...
Wash Buff/GeneJET NGS Cleanup

Wash Buff/GeneJET NGS Cleanup

do týdne
2 801,15 Kč
2 315,00 Kč bez DPH
40 ml
Silica micro column based fast DNA fragment cleanup and NGS adapter removal.