Sequencing
Probíhá načítání komponenty
1 231,78 Kč
1 018,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
1 231,78 Kč
1 018,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
1 236,62 Kč
1 022,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
1 236,62 Kč
1 022,00 Kč bez DPH
5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'
M13 pUC sequencing primers are single-stranded olig...
1 246,30 Kč
1 030,00 Kč bez DPH
5'-d(CAGGAAACAGCTATGAC)-3'
M13 pUC sequencing primers are single-stranded oligonucl...
1 246,30 Kč
1 030,00 Kč bez DPH
5'-d(GTAAAACGACGGCCAGT)-3'
M13 pUC sequencing primers are single-stranded oligonucle...
1 246,30 Kč
1 030,00 Kč bez DPH
5'-d(GTTTTCCCAGTCACGAC)-3'
M13 pUC sequencing primers are single-stranded oligonucl...
1 251,14 Kč
1 034,00 Kč bez DPH
Primers for sequencing of DNA fragments located downstream from the corresponding RN...
1 258,40 Kč
1 040,00 Kč bez DPH
5'-d(GAGCGGATAACAATTTCACACAGG)-3'
M13 pUC sequencing primers are single-st...
1 885,18 Kč
1 558,00 Kč bez DPH
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR...
1 885,18 Kč
1 558,00 Kč bez DPH
Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR...
2 801,15 Kč
2 315,00 Kč bez DPH
Silica micro column based fast DNA fragment cleanup and NGS adapter removal.