CloneJET™ PCR Cloning Kit

Kód produktu: K1232 Kód výrobce: K1232 Kód dodavatele: {0DE61240-17D7-4237-9EAB-090EB214F4ED} Výrobce: UAB Fermentas
7 816,60 Kč
6 460,00 Kč bez DPH
40 react

CloneJET PCR Cloning Kit is a positive selection system for efficient cloning of PCR products generated with any thermostable DNA polymerase.
Zobraz detailní popis

Detailní popis

The Thermo Scientific CloneJET PCR Cloning Kit is an advanced positive selection system for high-efficiency cloning of PCR products generated with any thermostable DNA polymerase. Any other blunt or sticky-end DNA fragment can be cloned. It is ideal for phosphorylated or non-phosphorylated DNA fragments. Ligation into the included positive selection vector takes only 5 minutes, yielding more than 99% recombinant clones. Blunt-ended PCR products generated with a proofreading enzyme are ligated directly into the cloning vector.

PCR products generated either with non-proofreading DNA polymerases or mixtures of DNA polymerases are blunted prior to ligation in 5 minutes with the thermostable DNA Blunting Enzyme provided with the kit. All common laboratory E. coli strains can be directly transformed with the ligation product.


The CloneJET PCR Cloning Kit contains a novel, ready-to-use positive selection cloning vector pJET1.2pJET1.2 sequence/blunt. The vector contains a lethal restriction enzyme gene that is disrupted by ligation of a DNA insert into the cloning site. As a result, only bacterial cells with recombinant plasmids are able to form colonies. Recircularized pJET1.2pJET1.2 sequence/blunt vector molecules lacking an insert express a lethal restriction enzyme, which kills the host E. coli cell after transformation. This positive selection drastically accelerates the process of colony screening and eliminates additional costs required for blue/white selection.

For convenience in mapping and manipulation of the insert, the pJET1.2pJET1.2 sequence/blunt cloning vector multiple cloning site contains two BglII recognition sequences that flank the insertion site. In addition, the vector contains a T7 promoter for in vitro and in vivo transcription as well as sequencing of the insert.


  • Fast – PCR cloning in only 5 minutes
  • Highest efficiency – > 99% of positive clones
  • No cloning background – positive selection vector
  • Versatile – ideal for blunt-end or sticky-end cloning
  • Economical – no expensive blue/white screening


  • Cloning of blunt-end or 3'-dA tailed PCR products up to 10 kb
  • Cloning of DNA fragments generated by restriction enzymes
  • Sequencing of cloned DNA
  • in vitro and in vivo transcription of cloned inserts from the T7 promoter


  • pJET1.2pJET1.2 sequence/blunt Cloning Vector
  • T4 DNA Ligase
  • 2X Reaction Buffer
  • DNA Blunting Enzyme
  • pJET1.2pJET1.2 sequence Forward Sequencing Primer (5’-CGACTCACTATAGGGAGAGCGGC-3’)
  • pJET1.2pJET1.2 sequence Reverse Sequencing Primer (5’-AAGAACATCGATTTTCCATGGCAG-3’)
  • Control PCR ProductpJET1.2 sequence
  • Water, nuclease-free
  • Detailed Protocol

Download sequences

  • pJET 1.2 Blunt Cloning Vector Map
  • pJET 1.2 Cloning Vector Sequence
  • Control PCR Product Sequence
gcccctgcagccgaattatattatttttgccaaataatttttaacaaaagctctgaagtcttcttcatttaaattcttag atgatacttcatctggaaaattgtcccaattagtagcatcacgctgtgagtaagttctaaaccatttttttattgttgta ttatctctaatcttactactcgatgagttttcggtattatctctatttttaacttggagcaggttccattcattgttttt ttcatcatagtgaataaaatcaactgctttaacacttgtgcctgaacaccatatccatccggcgtaatacgactcactat agggagagcggccgccagatcttccggatggctcgagtttttcagcaagatatctttctagaagatctcctacaatattc tcagctgccatggaaaatcgatgttcttcttttattctctcaagattttcaggctgtatattaaaacttatattaagaac tatgctaaccacctcatcaggaaccgttgtaggtggcgtgggttttcttggcaatcgactctcatgaaaactacgagcta aatattcaatatgttcctcttgaccaactttattctgcattttttttgaacgaggtttagagcaagcttcaggaaactga gacaggaattttattaaaaatttaaattttgaagaaagttcagggttaatagcatccattttttgctttgcaagttcctc agcattcttaacaaaagacgtctcttttgacatgtttaaagtttaaacctcctgtgtgaaattattatccgctcataatt ccacacattatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgtt gcgctcactgccaattgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagag gcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggta tcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggcca gcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaa atcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtg cgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatag ctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccg accgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccact ggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactag aaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaac aaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcct ttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaag gatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgaca gttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtc gtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggc tccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatcc agtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctaca ggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatc ccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcac tcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactca accaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccaca tagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagat ccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaa acaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaata ttattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaatagggg ttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaatagg cgtatcacgaggcc
>Control PCR Product Sequence (976bp) (from #K1231, #K1232 CloneJET PCR Cloning Kit


Prior to electroporation, always column-purify the ligation mixture using e.g. GeneJET PCR Purification Kit #K0701 or chloroform to extract it. Electroporation is inhibited by the presence of proteins and salts in the mixture.

Hazardous No
Quality Control The kit is functionally tested by cloning a control 3'-dA tailed PCR product. Typical yield of recombinant clones is >99%. The cloning vector is tested in a self-ligation experiment for the absence of cloning background. The pJET1.2 primers are tested for specific and efficient sequencing.
Storage Condition -20 C

Obsah balení

40 rxns

Hodnocení produktu

Produkt zatím nikdo nehodnotil, buďte první!

Napište hodnocení