Tento e-shop využívá cookies

Na našich webových stránkách používáme soubory cookies. Některé z nich jsou nezbytné, zatímco jiné nám pomáhají vylepšit tento web a váš uživatelský zážitek. Souhlasíte s používáním všech cookies?

Cookies nastavení

Vaše soukromí je důležité. Můžete si vybrat nastavení cookies níže.

T7 promoter Sequencing Primer, 20-mer

Kód produktu: SO118 Kód výrobce: SO118 Kód dodavatele: {84D7197C-241A-474E-A592-A9311C9FB304} Výrobce: Life Technologies Czech Republic s.r.o.
1 478,62 Kč
1 222,00 Kč bez DPH
do týdne
0.1 AU
Primers for sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II
Zobraz detailní popis

Detailní popis

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the SP6, T3, or T7 RNA polymerase promoter regions respectively. Primers are supplied as 10 µM aqueous solutions.

Applications

  • Sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control

Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog Promoter sequence
SO116 SP6 promoter sequencing primer, 18-mer 5'-d (ATTTAGGTGACACTATAG)-3' 
SO117 SP6 promoter sequencing primer, 24-mer 5'-d (CATACGATTTAGGTGACACTATAG)-3' 
SO118 T7 promoter sequencing primer, 20-mer 5'-d (TAATACGACTCACTATAGGG)-3' 
SO119 T3 promoter sequencing primer, 17-mer 5'-d (ATTAACCCTCACTAAAG)-3' 
SO120 T3 promoter sequencing primer, 24-mer 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3' 

Note

Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Hazardous No
Storage Condition -20 C

Hodnocení produktu

Produkt zatím nikdo nehodnotil, buďte první!